|
Thermo Fisher
5 μg/ml anti-zo-1 antibody 5 μg/Ml Anti Zo 1 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 μg/ml anti-zo-1 antibody/product/Thermo Fisher Average 90 stars, based on 1 article reviews
5 μg/ml anti-zo-1 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
zo-1 Zo 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo-1/product/Thermo Fisher Average 90 stars, based on 1 article reviews
zo-1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit Rabbit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit/product/Cell Signaling Technology Inc Average 97 stars, based on 1 article reviews
rabbit - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti-zo-1 antibody Anti Zo 1 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-zo-1 antibody/product/Thermo Fisher Average 90 stars, based on 1 article reviews
anti-zo-1 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
zo 1 Zo 1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo 1/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
zo 1 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti-mouse zo-1 Anti Mouse Zo 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-mouse zo-1/product/Thermo Fisher Average 90 stars, based on 1 article reviews
anti-mouse zo-1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti-zo-1 Anti Zo 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-zo-1/product/Thermo Fisher Average 90 stars, based on 1 article reviews
anti-zo-1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit anti zo 1 Rabbit Anti Zo 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti zo 1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
rabbit anti zo 1 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti zo 1 Anti Zo 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti zo 1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
anti zo 1 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit polyclonal anti-zona occludens (zo)-1 Rabbit Polyclonal Anti Zona Occludens (Zo) 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti-zona occludens (zo)-1/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-zona occludens (zo)-1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti-zo-1 rabbit polyclonal antibody Anti Zo 1 Rabbit Polyclonal Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-zo-1 rabbit polyclonal antibody/product/Thermo Fisher Average 90 stars, based on 1 article reviews
anti-zo-1 rabbit polyclonal antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
polyclonal rabbit anti-zo-1 antibody no. 61–7300  Polyclonal Rabbit Anti Zo 1 Antibody No. 61–7300, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal rabbit anti-zo-1 antibody no. 61–7300/product/Thermo Fisher Average 90 stars, based on 1 article reviews
polyclonal rabbit anti-zo-1 antibody no. 61–7300 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Gastroenterology
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
doi: 10.1186/1471-230X-12-128
Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies
Article Snippet: ZO-1 , fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C ,
Techniques: Sequencing
Journal: BMC Gastroenterology
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
doi: 10.1186/1471-230X-12-128
Figure Lengend Snippet: Expression of tight junction-related components in esophageal mucosa in patients with GERD
Article Snippet: ZO-1 , fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C ,
Techniques: Expressing
Journal: BMC Gastroenterology
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
doi: 10.1186/1471-230X-12-128
Figure Lengend Snippet: Immunohistochemical stainings of tight junction-related proteins in esophageal mucosa. Occludin, Claudin-1, -2 and ZO-1,-2 are displayed by brown or red staining, respectively. Panels illustrate representative staining for controls and samples obtained from patients with NERD. Immunohistochemical staining was observed in the esophageal squamous epithelium mainly at the basal and suprabasal zone. Claudin-1/2 and ZO-1 showed partly a membranous staining. (Zeiss Axioskop 50; camera: Nikon coolpix 990).
Article Snippet: ZO-1 , fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C ,
Techniques: Immunohistochemical staining, Staining